OPCML is hypermethylated in a subset of patients with metaplastic changes in their esophagus

Recruitment of patients within the esophageal adenocarcinoma cascade

One hundred fifty two predominantly Caucasian subjects who underwent upper gastrointestinal endoscopy at the Prince of Wales Hospital (Sydney) for examination of their gastrointestinal symptoms were recruited prospectively. Subjects who had been prescribed antibiotics or non-steroidal anti-inflammatory drugs in the two-month period prior to recruitment were excluded. A set of two samples were collected at endoscopy, one sample for assessment of OPCML methylation locally (esophageal tissue) and another from the same location for histological analysis to be conducted by the pathology services at Prince of Wales Hospital. Histological analysis grouped patients into four groups (normal esophagus, n = 89; GERD, n = 42; GM, n = 20; EAC, n = 1). In a subset of patients (GM, n = 11), additional samples histologically classified as normal from regions adjacent to the GM region were collected. Further, three samples (normal, GM, and EAC regions) were collected from one patient diagnosed with EAC. All samples were snap-frozen in cryotubes following collection and stored at − 80 °C until processing. Ethics approval was obtained from the South Eastern Sydney Local Health District Human Research Ethics Committee (HREC 13/375 and HREC 16/020). All subjects recruited to the study signed a written informed consent, and all experiments were performed in accordance with relevant guidelines and regulations.

Recruitment of patients within Correa’s (gastric adenocarcinoma) cascade

The gastric adenocarcinoma (GAC) cascade study population comprises Mestizo individuals (54 non-cardia GAC cases and 55 age-matched functional dyspepsia controls) from Pereira, a city located in the Colombian Andes mountain range, who underwent upper gastrointestinal endoscopy at Comfamiliar Risaralda Hospital. Patients known to be infected with the Human Immunodeficiency Virus, who have any comorbidity associated with immunosuppression or who had been prescribed non-steroidal anti-inflammatory drugs, anti-microbial agents or acid suppressants in the three-month period prior to recruitment were excluded. As Colombian individuals present with GAC early in life, subjects > 30 years were recruited, the critical age from which the incidence increases steadily thereafter in this population. In addition, 91 subjects with gastric precancerous lesions composed of 40 subjects with atrophic gastritis, 40 subjects with intestinal metaplasia and 11 subjects with dysplasia, based on histological assessment by experienced pathologists, have been included. In addition to gastric biopsies for histological assessment, a blood sample for assessment of OPCML methylation systemically was collected at endoscopy. Blood samples (5 ml) were collected intravenously in BD Vacutainer® SST™ Blood Collection Tubes and immediately stored at − 20 °C until they were shipped frozen on dry ice to Australia. Samples were then stored at − 20 °C until processing. Ethics approvals have been gained from Comfamilar Risaralda Hospital (Acta 5140) and the University of New South Wales (UNSW) (HREC 16010) human research ethics committees.

Growth and maintenance of human cell lines

HET-1A cells were grown in 10 ml cell culture media comprising LHC-9 media (Catalog no. 12680013, ThermoFisher Scientific; Scoresby, Vic, Australia) supplemented with 10% heat-inactivated fetal bovine serum (hi-FBS) and 100 μg/ml penicillin/streptomycin, in 25 cm² tissue culture flasks at 37 °C with 5% CO₂. CP-A, CP-B, CP-C, and CP-D were grown in Keratinocyte-SFM media (Catalog no. 17005042, ThermoFisher Scientific) supplemented with prequalified human recombinant Epidermal Growth Factor 1–53 (5 μg/l), Bovine Pituitary Extract (50 mg/l), 10% hi-FBS and 100 μg/ml penicillin/streptomycin. OE33, AGS, and LS 174 T cells were grown in Roswell Park Memorial Institute (RPMI) media supplemented with 10% hi-FBS and 100 μg/ml penicillin/streptomycin. Caco-2 cells were grown in Minimum Essential Medium supplemented with 10% hi-FBS, 1 mM sodium pyruvate, 0.1 mM non-essential amino acids, 2.25 mg/1 sodium bicarbonate and 100 μg/ml penicillin/streptomycin.

DNA extraction

Our recruitment of the two study cohorts resulted in two types of samples: 1) mucosal samples from the esophagus of subjects recruited to the EAC cascade cohort; 2) blood samples collected intravenously from subjects recruited to the GAC cascade cohort. DNA was extracted from esophageal samples and human cell-lines using Gentra Puregene Tissue kit (Qiagen; Chadstone Centre, Vic, Australia) according to the manufacturer’s instructions. DNA was extracted from blood samples using the QIAamp DNA Blood Mini Kit (Qiagen) according to the manufacturer’s instructions.

Custom OPCML methylation assay

The custom OPCML methylation assay was performed using services and facilities available at the Australian Genome Research Facility Ltd. All pyrosequencing assays were designed using the algorithms built into the PyroMark Assay Design Software (Version 2.0.1, Qiagen). Briefly, approximately 200 bp of reference sequence surrounding the target CpG sites (OPCML exon 1) were inputted into the software. CpG sites were selected as target sites for analysis and primers designed to target these sites were chosen from a list generated by the software on the basis of the algorithms’ predicted assay quality. The forward PCR primer for the OPCML assay was TTGGGATGAAGAGTAGGGTAGT, the reverse PCR primer was 5′Biotin-CTCCCTCCCTTTACAAACATT, and the sequencing primer was TGAAGAGTAGGGTAGTT.

DNA samples were converted using the Epitect Bisulphite Conversion Kit (Qiagen). 500 ng of genomic DNA were converted overnight in a total volume of 140 μl using the standard protocol from the kit. Converted DNA was isolated on provided columns and stored at − 20 °C. The assay regions containing the CpG target sites were PCR amplified using a biotin labelled, HPLC purified primer and standard sequencing grade primer. All PCR amplifications were performed with the PyroMark PCR Kit (Qiagen). Amplification reactions consisted of 12.5 μl PyroMark Mastermix, 2.5 μl Coral Load, 1 μl of each of 5 μM forward and reverse primers, 2 μl of bisulphite converted template DNA, and 6 μl of water. Thermocycling conditions consisted of 15 min at 95 °C followed by 45 cycles of 30 s at 95 °C, 30 s at 56 °C and 30 s at 72 °C and a final extension step of 10 min at 72 °C. All amplifications were visualised on 2% agarose gels to confirm quality and estimate concentration.

The PCR product was bound to Streptavidin Sepharose High Performance beads (GE Healthcare Life Sciences; Parramatta, NSW, Australia), the beads containing the immobilized PCR product were denatured and washed using proprietary solutions (Qiagen) on the Pyrosequencing Vacuum Prep Tool (Qiagen) to isolate a single stranded template. The beads were then transferred to an optically clear, 24-well sequencing plate in 0.3 μM of pyrosequencing primer. Annealing to the single-stranded template was done by heating the plate to 80 °C followed by cooling to room temperature. Pyrosequencing was performed on a PyroMark 24 Pyrosequencing System (Qiagen) as per the manufacturer’s instructions. Data was analyzed on the PyroMark Q24 software to give the methylation values (%) for each CpG site in the sample.

Statistics

Comparisons of OPCML methylation levels across patient groups were performed using one-way ANOVA with post hoc Tukey’s test and false discovery rate correction where applicable.

OPCML methylation in esophageal samples of patients within the esophageal adenocarcinoma cascade

Methylation levels of three CpG sites within exon 1 of OPCML (position 1: hg19_chr11:133402185; CpG site: cg19151121) were measured in esophageal samples from patients within the EAC cascade. We observed significantly higher levels of methylation across the three positions in patients that had histologically detectable glandular mucosa (GM) as compared to patients with a normal esophagus and those with gastro-esophageal reflux disease (GERD) (Fig. 1a-c). However, on further analysis, it was clear that there was no consistent methylation pattern across the GM group (Fig. 1d), and the significant differences with respect to normal and GERD patients were driven by intermediate to high methylation patterns in a specific subgroup of GM patients.

Importantly, of the 20 patients with GM, normal esophageal tissue samples (confirmed histologically) from 11 of the patients were collected from regions adjacent to the GM region. No hypermethylation was observed in the normal tissue from these patients (Fig. 1e).

As part of the prospective enrolment of subjects, one EAC patient was recruited. During endoscopy, the patient was visually suspected to have an EAC, and thus, three samples were collected from regions that were later histological confirmed as normal, GM and EAC. OPCML methylation was confirmed to show a step-wise increase across the three sites and three positions (Fig. 1f).

OPCML methylation in human cell-lines

Given the signature observed in the esophageal samples from patients within the EAC cascade, we then measured methylation levels of the same three sites within OPCML in nine esophageal, gastric and intestinal cell-lines. Methylation patterns were consistent across all three positions (Fig. 2a-c). Cell-lines derived from upper gastrointestinal adenocarcinomas (OE33 and AGS) were methylated higher as compared to those derived from lower gastrointestinal adenocarcinomas (LS 174 T and Caco-2; Fig. 2). Despite the fact that EAC cascade cell-lines CP-B, CP-C and CP-D are derived from areas of high grade dysplasia while CP-A is derived from an area of nondysplastic metaplasia [13, 14], we observed low levels of methylation for CP-A, CP-B and CP-C when compared to CP-D (Fig. 2). In fact, CP-D showed similar methylation levels to the EAC cell-line OE33. Surprisingly, we observed intermediate levels of OPCML methylation in immortalized primary normal esophageal cells HET-1A (Fig. 2).

OPCML methylation in blood of patients within the gastric adenocarcinoma cascade

Given that peripheral blood mononuclear cells (PBMCs) do not express OPCML [1] and OPCML is hypermethylated in GAC tissue [10], we then recruited a cohort of patients across the GAC cascade (n = 200) and collected blood intravenously. This was performed to validate our PyroMark assay and local tissue results in a large cohort of patients within an inflammatory adenocarcinoma cascade employing samples (i.e. blood) that should not show elevated methylation levels of OPCML. OPCML methylation was measured in DNA extracted from blood samples (Fig. 3). OPCML methylation of exon 1 fluctuated around levels detected in normal tissues (mean (%) ± SD; position 1: 8.4 ± 2.5; position 2: 7.2 ± 2.2; position 3: 5.1 ± 1.5). No differences in OPCML methylation in blood derived from patients across the GAC cascade were observed (Fig. 3a-c).