Skip to main content

Advertisement

Table 1 Primers for qRT-PCR

From: Suitability of Yin Yang 1 transcript and protein levels for biomarker studies in B cell non-Hodgkin lymphoma

Gene Primer sequence (5´➔3´) Amplification efficiency/r2
YY1 fwd ACCTGGCATTGACCTCTCAG 101% / 0.996
rev TGCAGCCTTTATGAGGGCAAG
GAPDH fwd TGGGTGTGAACCATGAGAAG 101% / 0.999
rev TCCACGATACCAAAGTTGTCA
RPS9 fwd GGGAAGCGGAGCCAACATG 98% / 0.998
rev GTTTGTTCCGGAGCCCATACT