Skip to main content

Table 1 Primer sequences of examined genes

From: NOS1-, NOS3-, PIK3CA-, and MAPK-pathways in skin following radiation therapy

Gene Sequence 5’to 3
MAPK Forward CAGTGGGATGGAATTGAAAG
  Reverse AGCAGAAGGAATGAGTGTGC
NOS1 Forward GACTGTTGAGATGGAAGAAC
  Reverse ATCTTCCTGTCTCCGAGGCG
NOS3 Forward GTGATGGCGAAGCGAGTGAAG
  Reverse CCGAGCCCGAACACACAGAAC
PIK3CA Forward CTCCACGACCATCATCAGG
  Reverse GATTACGAAGGTATTGGTT