Skip to main content

Table 1 Oligonucleotide primers used for PCR

From: Suspected anemia caused by maternal anti-Jra antibodies: a case report

PCR (target) Primer name Nucleotide sequence (5′–3′)
JRA337/376/1515-SSP
 PCR-1 (Exon 13) JRA1515-F4 AAGTCAAAGGCAGATGCTTC
 PCR-2 (Exon 13) JRA1515-R2 CCTTATCAGAGCAAACAGAG
 PCR-3 (Exon 4) JRA376-F4 CCAAGTGGATTATCTGGAGATG
 PCR-4 (Exon 4) JRA376-R6 TTGTCTCCTTTGTCTTTTACCAAACCCACTAATACTTTCTTG
 PCR-5 (Exon 4) JRA376-R1 CAAACCCACTAATACTTACTTA
 PCR-6 (Exon 4) JRA337-R10 TACATTTGAAATTGCCAGGTCA
 PCR-7 (Exon 4) GPC4-3 TGTGGCATTGTATCTTGTCCT
 PCR-8 (Exon 4) GPC4-4 GTGGCTATCTCGGGAAGAAT
JRA34/421-SSP
 PCR-9 (Exon 2) JRA34-F2 TGGTATGGGCCATTCATTG
 PCR-10 (Exon 2) JRA34-R7 CATTGGTGTTGCCTCGTGACAT
 PCR-11 (Exon 2) JRA34-R10 CTTCGACAGCGCCCCTTCGGATTGGTGTTGCCTCGTGACAC
 PCR-12 (Exon 5) JRA421-F4 CTGACAGTGAGAGAAAACTTAA
 PCR-13 (Exon 5) JRA421-15 ACTACAACACTACCCGTGAGTGACGGTGAGCGAAAACTTAC
 PCR-14 (Exon 5) JRA421-R2 CACTTTATCCAGACCTAACTC-3′