Skip to main content

Advertisement

Fig. 4 | Biomarker Research

Fig. 4

From: BAP1 hereditary cancer predisposition syndrome: a case report and review of literature

Fig. 4

Germline BAP1 missense mutation found in this patient. Germline DNA was extracted from the patient’s blood and analysed by Sanger sequencing. DNA amplification and sequencing were performed as previously described (Forward primer: GGAGTTGGCCAAGGCCCATAATAGC; reverse primer: CCTGGATACTCTCTGTCCCTCCCAAAG) [1]. Electropherogram shows BAP1 missense mutation (g.52441252A > G) within exon 7. This mutation produces an amino-acid sequence switch from tyrosine to cysteine in the ubiquitin hydrolase domain (UCH), and indicated by the diagram

Back to article page