Skip to main content

Table 3 Complete primer sequences and gene bank accession numbers of selected genes analyzed in RT-qPCR

From: Whole gene expression profile in blood reveals multiple pathways deregulation in R6/2 mouse model

Gene symbol Ref seq Primer sequence Forward Primer sequence Reverse
C3 K02782, NM_009778 GGTGTGCTGAAGAGAACT TGAGCCTGACTTGATGAC
Serping1 NM_009776 AAAGTAAAGAGCAGCCAAGACA CAGGTTGAGATCGTAAGTGAAGT
Slc27a2 NM_011978 TGAAGAAGTGAATGTGTATGG TCTCAATGGTATCTTGTATCCT
Fabp1 NM_017399 CGTGACTGAACTCAATGG TTCTCTTGCTGACTCTCTT
Slc8a1 NM_011406 TCCATCCAGTAGACTTCGTGAT CCAAGCAATTCCTTACAGAGTGA
Tmp2 NM_009416 AGCCCAAGCGGACAAGTA CGGGTCTCAGCCTCTTTCA